@ KEY ARTICLE: Coliforms. Dangerous Biological Bioterrorism Agents.
"The discovery of novel aetiological agents responsible for ‘unexplained infectious disease syndromes’ relies quite heavily on the description of novel microbes. Although standard or unusual forms of known microbes are sometimes considered to be novel causes of ‘unexplained infectious disease syndromes’, most of the novel causes are indeed previously undescribed microbes."
Thursday, December 17, 2015
Monday, October 19, 2015
Tuesday, October 13, 2015
PHOMA sp. production of melanin complexes |
>Contig_1
ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA
@ NCBI BLAST
ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA
@ NCBI BLAST
Thursday, October 8, 2015
Epicoccum nigrum (synanamorph and/or teleomorph of Phoma)
Epicoccum nigrum synthesizes extracellular fungal polysaccharide, called epiglucan.
@ Chronic Exposure To Alternaria Tenuis, Pullularia Pullulans, And Epicoccum Nigrum May Lead To Symptoms Of Neuropsychological Illnesses: Evidence From A Comprehensive Evaluation
@ ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species
PHOMA HERBARUM This mold is commonly found in different soils, dead plant tissues, and potatoes. It grows indoors in association with bio‑deterioration of wall paints, and produces pink or purple colour spots. This mold has also been isolated from moldy shower curtains.
PHOMA HERBARUM This mold is commonly found in different soils, dead plant tissues, and potatoes. It grows indoors in association with bio‑deterioration of wall paints, and produces pink or purple colour spots. This mold has also been isolated from moldy shower curtains.
PHOMA sp. |
"The synanamorphs and teleomorphs of Phoma have been poorly investigated thus far, except for the P. lingam complex. Few synanamorph relationships have thus far been confirmed by means of molecular techniques. Arenal et al. (2000, 2004) demonstrated P. epicoccina and Epicoccum nigrum to be synanamorphs by employing ITS sequence data, and synonymised these species after further microscopical studies."
@ Biology and recent developments in the systematics of Phoma, a complex genus of major quarantine significance.
Monday, September 28, 2015
PLEOSPORA (PHOMA Sp.) |
Coelomycetes are being recovered with increasing frequency in human disease.
They are frequently acquired by traumatic implantation and are of concern in profoundly
immunosuppressed individuals. A definition of this group of organisms is
provided, along with their clinical manifestations, methods for laboratory diagnosis,
criteria for identification, in vitro susceptibility data, and guidelines for antifungal
therapy and management.
Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identification and therapy Deanna A. Sutton
Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identification and therapy Deanna A. Sutton
Subscribe to:
Posts (Atom)