Media Blackout - Obama Sneakily Issues Executive Orders Giving Power to a ‘Global Health Security Agenda’ for Infectious Disease Threats
Thursday, February 16, 2017
Friday, December 23, 2016
Moderna's Mysterious Medicines

"In a hot biotech venture market, Moderna Therapeutics is ablaze. Based in Cambridge, Massachusetts, and shrouded in secrecy, the startup claims to be developing a new class of drug that hacks the very operating system of life, turning human bodies into drug factories by directing cells to produce therapeutic proteins"
Sunday, December 18, 2016
Monday, July 11, 2016
a dangerous new biological threat had penetrated the nation's borders."
Monday, June 20, 2016
Some bacteria naturally grow as filaments, e.g., members of the actinomycetes.
Many others, e.g.,E. coli and B. subtilis, make filaments only when under stress — a fact that has been known for about one hundred years but is still a bit of a mystery.
"WHY DO BACTERIA FILAMENT"
by: Moselio (Elio) Schaechter & Roberto Kolter
Saturday, June 18, 2016
Thursday, May 5, 2016
Superbug known as ‘phantom menace’ on the rise in U.S
"Experts warned that the latest development was frightening."
"History shows that these mobile resistance genes can spread around the world quickly, silently riding in people, animals and food," said Lance Price, director of the Antibiotic Resistance Action Center at George Washington University's Milken Institute of Public Health, in a statement."
Thursday, December 17, 2015
@ KEY ARTICLE: Coliforms. Dangerous Biological Bioterrorism Agents."The discovery of novel aetiological agents responsible for ‘unexplained infectious disease syndromes’ relies quite heavily on the description of novel microbes. Although standard or unusual forms of known microbes are sometimes considered to be novel causes of ‘unexplained infectious disease syndromes’, most of the novel causes are indeed previously undescribed microbes."
Monday, October 19, 2015
Tuesday, October 13, 2015

![]() |
| PHOMA sp. production of melanin complexes |
>Contig_1
ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA
@ NCBI BLAST
ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA
@ NCBI BLAST
Thursday, October 8, 2015
Epicoccum nigrum (synanamorph and/or teleomorph of Phoma)
Epicoccum nigrum synthesizes extracellular fungal polysaccharide, called epiglucan.

@ Chronic Exposure To Alternaria Tenuis, Pullularia Pullulans, And Epicoccum Nigrum May Lead To Symptoms Of Neuropsychological Illnesses: Evidence From A Comprehensive Evaluation
@ ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species
PHOMA HERBARUM This mold is commonly found in different soils, dead plant tissues, and potatoes. It grows indoors in association with bio‑deterioration of wall paints, and produces pink or purple colour spots. This mold has also been isolated from moldy shower curtains.
PHOMA HERBARUM This mold is commonly found in different soils, dead plant tissues, and potatoes. It grows indoors in association with bio‑deterioration of wall paints, and produces pink or purple colour spots. This mold has also been isolated from moldy shower curtains.
Subscribe to:
Comments (Atom)







































