Tuesday, June 13, 2017



Multidrug-resistant infections rising in US kids


"Once these organisms are in the community,  .
..they will spread," 

Meropol said:
 "We can catch them anywhere."





Monday, July 11, 2016


     "In early April, experts at a military lab outside Washington intensified their search for evidence that: 
             a dangerous new biological threat had penetrated the nation's borders."


  'A slow catastrophe unfolds´ as the golden age of antibiotics comes to an end. 

    “It’s not apocalyptic until it is,”  said Peter Pitts, president of the Center for Medicine in the Public Interest 
     and former associate commissioner of the FDA. 







                        

Monday, June 20, 2016





Some bacteria naturally grow as filaments, e.g., members of the actinomycetes. 
Many others, e.g.,E. coli and B. subtilis, make filaments only when under stress — a fact that has been known for about one hundred years but is still a bit of a mystery.

"WHY DO BACTERIA FILAMENT"


by: Moselio (Elio) Schaechter & Roberto Kolter











Then and now: use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories





Thursday, May 5, 2016



                                                                                                                                           
Superbug known as ‘phantom menace’ on the rise in U.S  

       


                   





                                                                                                                                                              "Experts warned that the latest development was frightening."                                     

 "History shows that these mobile resistance genes can spread around the world quickly, silently riding in people, animals and food," said Lance Price, director of the Antibiotic Resistance Action Center at George Washington University's Milken Institute of Public Health, in a statement."

Tuesday, October 13, 2015




Classification Peyronellaea pomorum var. Cyanea


















PHOMA sp. production of melanin complexes



>Contig_1

ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA



NCBI BLAST