SILENTSUPERBUG WAYBACK

 

DISCOVERY REPORT Gut fungi are associated with human genetic variation 

and disease risk 

Emily P. Van Syoc1,2*, Emily R. Davenport1,2, Seth R. Bordenstein 1,2,3* 1 One Health Microbiome Center, Huck Institutes of the Life Sciences, The Pennsylvania State University, University Park, Pennsylvania, United States of America, 2 Department of Biology, The Pennsylvania State University, University Park, Pennsylvania, United States of America, 3 Department of Entomology, The Pennsylvania State University, University Park, Pennsylvania, United States of America

 

Academic Editor: Jotham Suez, Johns Hopkins University Bloomberg School of Public Health, UNITED STATES OF AMERICA

 

MERICAReceived: March 28, 2025 Accepted: July 30, 2025 

Published: September 2, 2025

IMAGES: PLEOSPORA SP.  SKIN COLONIZATION / FOLLICULITIS 

The other black fungi: exploring the opportunists in the order Pleosporales

Sarah Ahmed - Ervin M Alcanzo - Qirui Li - Nadir Musa Abuzeid -Xin Zhou - Peiying Feng - Dea Garcia-Hermoso - Sybren de Hoog

 

"Additionally, deep-seated infections generally exhibit a predilection for immunocompromised hosts, but cases with cerebral dissemination are more common in immunocompetent individuals. "

Appeared online 25 March 2025

Medical Professional Monograph LL-37 

Online first June 17, 2025

Olorofim for the treatment of invasive fungal diseases in patients with few or no therapeutic options: 

a single- arm, open-label, phase 2b study    

Antifungal activity of Miltefosine against both azole-susceptible and -resistant Aspergillus strains

Iman Haghania - Zahra Yahyazadeh - Mohammad Taghi Hedayati-Tahereh Shokohi - Hamid Badali - Shaghayegh Khojasteh - Javad Akhtari - Javad Javidnia - Maryam Moazeni - Ahmed Al-Harrasi - Seyed Reza Aghili - Firoozeh Kermani - Zohreh Hajheydari - Abdullah M.S. Al Hatmi - Mahdi Abastabar 

 

A fungus that can ‘eat you from the inside out’ could spread as the world heats up.

By Laura Paddison

*

Image 01: Content Provider: CDC/ Robert Simmons. Photo Credit:Janice Haney Carr / asexual stage Aspergillus sp. 

Image 02: Content Provider; CDC/ Dr. Libero Ajello / Aspergillus Flavus

 

Deadly fungus that 'eats you from the inside out' invades US: 'Hundreds of thousands of lives at risk'

By OSHEEN YADAV FOR DAILYMAIL.COM

Pan-azole- and multi-fungicide-resistant Aspergillus fumigatus is widespread in the United States

Authors: B. N. Celia-Sanchez, B. Mangum, L. F. Gómez Londoño, C. Wang, B. Shuman, M. T. Brewer, M. Momany

Climate change-driven geographical shifts in Aspergillus species habitat and the implications for plant and human health

Norman van Rhijn 1, Christopher Uzzell 2, Jennifer Shelton 3

1 University of Manchester, 2 Liverpool School of Tropical Medicine, 3 UK Centre for Ecology & Hydrology

News Release 3-Jun-2025

Cannabis extract could treat fungal diseases

Peer-Reviewed Publication

Macquarie University’s Dr Hue Dinh, a postdoctoral research fellow in the School of Natural Science, and Associate Professor Amy Cain, resolved to tackle the growing threat of fungal infections with help from Professor Mark Connor and Dr Marina Junqueira Santiago from the Macquarie School of Medicine and collaborators at the Universities of Sydney and NSW.

Writer: Bianca Nogrady

       UN PLEDGES TO CUT SUPERBUG DEATHS BY 2030           By Misbah Khan

   World Leaders Approve Milestone Commitment to Reduce Deaths 

                         from Antibiotic Resistance by 10% by 2030

                                          Antimicrobial Resistance 26/09/2024 • Elaine Ruth Fletcher

WORLDWIDE: TRICHOPHYTON INDOTINEAE

Trichophyton indotineae—An Emerging Pathogen Causing Recalcitrant Dermatophytoses in India and Worldwide—A Multidimensional Perspective.

Silke Uhrlaß, Shyam B. Verma, Yvonne Gräser, Ali Rezaei-Matehkolaei, Maryam Hatami, Martin Schaller, and Pietro Nenoff.†

Emmanuella Guenova, Academic Editor

 

In June 2024, the first case of sexually-transmitted Trichophyton mentagrophytes genotype VII in the United States was reported.

Superficial Fungal Infections and Implantation Mycoses: What’s New?

Jeremy Gold, MD, MS,  Shari Lipner, MD, PhD, Flavio Queiroz-Telles, MD, PhD, FCMM, Dallas Smith, PharmD

Are you aware of the recent emergence of resistant dermatophytosis in the United States? This includes the recent report of the first case of sexually-transmitted Trichophyton mentagrophytes Genotype VII (TMVII) in the United States.

Healthcare providers should be aware of emerging strains of dermatophytes causing severe ringworm.                                    Diagnosis often requires specialized testing only available at select reference laboratories. 

 

The silent pandemic: how drug-resistant superbugs risk becoming the world’s
number one killer

 

Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera

M.M. Aveskamp, J. de Gruyter, H.C. Woudenberg, G.J.M. Verkley, and P.W. Crous

An almost completely unexplored habitat of Phoma spp. is the marine environment (Kohlmeyer & Volkmann-Kohlmeyer 1991),

in which Phoma species are regularly found that are completely new to science (e.g. Osterhage et al. 2000, Yarden et al. 2007).

 

PLEOSPORA

                                                                                                                                                                                                      >Contig_1

ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA


@ NCBI BLAST

 

Can’t quite develop that dangerous pathogen? AI may soon be able to help
By Allison Berke | November 7, 2023

Friend or foe? Washington is vexed by an uninvited visitor

AMR Exchange: Antifungal Resistance: Understanding this Growing Global Threat

 

'No common symptoms' for deadly fungal disease sweeping US poses 'challenges' for experts

Story by Fionnuala Boyle

CDC says cases of lethal fungus tripled in recent years

Candida auris was reported in the US in 2016

The synanamorphs and teleomorphs of Phoma have been poorly investigated thus far, except for the P. lingam complex. Few synanamorph relationships have thus far been confirmed by means of molecular techniques. Arenal et al. (2000, 2004) demonstrated P. epicoccina and Epicoccum nigrum to be synanamorphs by employing ITS sequence data, and synonymised these species after further microscopical studies." 

Biology and recent developments in the systematics of Phoma, a complex genus of major quarantine significance.

M. Aveskamp, J. Gruyter, P. Crous

The other black fungi: exploring the opportunists in the order Pleosporales

Sarah Ahmed - Ervin M Alcanzo - Qirui Li - Nadir Musa Abuzeid -Xin Zhou - Peiying Feng -

Dea Garcia-Hermoso - Sybren de Hoog

"Additionally, deep-seated infections generally exhibit a predilection for immunocompromised hosts, but cases with cerebral dissemination are more common in immunocompetent individuals. "

Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identification and therapy 

Deanna A. Sutton

Coelomycetous Fungi in the Clinical Setting: Morphological Convergence and Cryptic Diversity

Nicomedes Valenzuela-Lopez, Deanna A. Sutton, José F. Cano-Lira, Katihuska Paredes, 

Nathan Wiederhold, Josep Guarro, and Alberto M. Stchigel

David W. Warnock, Editor

David W. Warnock, University of Manchester;

The phoma-like dilemma

, ,   

Rungtiwa Phookamsak, Jian-Kui Liu, Eric H. C. McKenzie, Dimuthu S. Manamgoda, Hiran Ariyawansa, Kasun M. Thambugala, Dong-Qin Dai, Erio Camporesi, Ekachai Chukeatirote, Nalin N. Wijayawardene, Ali H. Bahkali, Peter E. Mortimer, Jian-Chu Xu & Kevin D. Hyde 

 

Resolving the Phoma enigma

"Results of a phylogenetic study including the type species of all nine Phoma sections and allied coelomycetous genera demonstrated that all nine sections grouped in the Pleosporales ." 

Q. Chen,  J.R. Jiang, G.Z. Zhang, L. Cai, and P.W. Crous

Pleosporales       

Ying Zhang,  Pedro W. Crous,  Conrad L. Schoch  and Kevin D. Hyde