UN PLEDGES TO CUT SUPERBUG DEATHS BY 2030                             By Misbah Khan

WORLDWIDE: TRICHOPHYTON INDOTINEAE

Trichophyton indotineae—An Emerging Pathogen Causing Recalcitrant Dermatophytoses in India and Worldwide—A Multidimensional Perspective.

Silke Uhrlaß, Shyam B. Verma, Yvonne Gräser, Ali Rezaei-Matehkolaei, Maryam Hatami, Martin Schaller, and Pietro Nenoff.†

Emmanuella Guenova, Academic Editor

 

In June 2024, the first case of sexually-transmitted Trichophyton mentagrophytes genotype VII in the United States was reported.

Superficial Fungal Infections and Implantation Mycoses: What’s New?

Jeremy Gold, MD, MS,  Shari Lipner, MD, PhD, Flavio Queiroz-Telles, MD, PhD, FCMM, Dallas Smith, PharmD

Are you aware of the recent emergence of resistant dermatophytosis in the United States? This includes the recent report of the first case of sexually-transmitted Trichophyton mentagrophytes Genotype VII (TMVII) in the United States.

Healthcare providers should be aware of emerging strains of dermatophytes causing severe ringworm.                                                          Diagnosis often requires specialized testing only available at select reference laboratories. 

 

The silent pandemic: how drug-resistant superbugs risk becoming the world’s number one killer

 

Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related pleosporalean genera

M.M. Aveskamp, J. de Gruyter, H.C. Woudenberg, G.J.M. Verkley, and P.W. Crous

An almost completely unexplored habitat of Phoma spp. is the marine environment (Kohlmeyer & Volkmann-Kohlmeyer 1991),

in which Phoma species are regularly found that are completely new to science (e.g. Osterhage et al. 2000, Yarden et al. 2007).

 

PLEOSPORA

                                                                                                                                                                                                      >Contig_1

ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA


@ NCBI BLAST

 

Can’t quite develop that dangerous pathogen? AI may soon be able to help
By Allison Berke | November 7, 2023

Friend or foe? Washington is vexed by an uninvited visitor

AMR Exchange: Antifungal Resistance: Understanding this Growing Global Threat

 

'No common symptoms' for deadly fungal disease sweeping US poses 'challenges' for experts

Story by Fionnuala Boyle

CDC says cases of lethal fungus tripled in recent years

Candida auris was reported in the US in 2016

The synanamorphs and teleomorphs of Phoma have been poorly investigated thus far, except for the P. lingam complex. Few synanamorph relationships have thus far been confirmed by means of molecular techniques. Arenal et al. (2000, 2004) demonstrated P. epicoccina and Epicoccum nigrum to be synanamorphs by employing ITS sequence data, and synonymised these species after further microscopical studies." 

Biology and recent developments in the systematics of Phoma, a complex genus of major quarantine significance.

M. Aveskamp, J. Gruyter, P. Crous

Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identification and therapy 

Deanna A. Sutton

Coelomycetous Fungi in the Clinical Setting: Morphological Convergence and Cryptic Diversity

Nicomedes Valenzuela-Lopez, Deanna A. Sutton, José F. Cano-Lira, Katihuska Paredes, 

Nathan Wiederhold, Josep Guarro, and Alberto M. Stchigel

David W. Warnock, Editor

David W. Warnock, University of Manchester;

The phoma-like dilemma

, ,   

Rungtiwa Phookamsak, Jian-Kui Liu, Eric H. C. McKenzie, Dimuthu S. Manamgoda, Hiran Ariyawansa, Kasun M. Thambugala, Dong-Qin Dai, Erio Camporesi, Ekachai Chukeatirote, Nalin N. Wijayawardene, Ali H. Bahkali, Peter E. Mortimer, Jian-Chu Xu & Kevin D. Hyde 

 

Resolving the Phoma enigma

"Results of a phylogenetic study including the type species of all nine Phoma sections and allied coelomycetous genera demonstrated that all nine sections grouped in the Pleosporales ." 

Q. Chen,  J.R. Jiang, G.Z. Zhang, L. Cai, and P.W. Crous

Pleosporales       

Ying Zhang,  Pedro W. Crous,  Conrad L. Schoch  and Kevin D. Hyde

A new pleosporalean fungus isolated from superficial to deep human clinical specimens.

Nicomedes Valenzuela-Lopez, M Teresa Martin-Gomez, Ibai Los-Arcos, Alberto M Stchigel, Josep Guarro, José F Cano-Lira   

  

Draft Genome Sequence of Dematiaceous Coelomycete Pyrenochaeta sp. Strain UM 256, Isolated from Skin Scraping

Authors: Su Mei Yew, Chai Ling Chan, Tuck Soon Soo-Hoo, Shiang Ling Na, Seong Siang Ong, Hamimah Hassan, Yun Fong Ngeow, Chee Choong Hoh, Kok Wei Lee, Wai Yan Yee, Kee Peng Ng   

Antimicrobial blue light inactivation of international clones of multidrug-resistant Escherichia coli ST10, ST131 and ST648

International clones of multidrug-resistant Escherichia coli have been a leading cause of human and animal infections worldwide. Microbial inactivation by blue light has been proposed as an effective treatment for superficial infections and surface contamination.

Carolina dos Anjos, Caetano P. Sabino, Vanessa Bueris, Miriam R. Fernandes, Fabio C.Pogliani, Nilton Lincopan, 

Fábio P. Sellera

Antimicrobial Blue Light And Quinine Combo Effective For Treatment Of Mold Infection: Study

New Insights into the Bacterial Targets of Antimicrobial Blue Light

Escherichia coli ST131, an Intriguing Clonal Group

In 2008, a previously unknown Escherichia coli clonal group, sequence type 131 (ST131), was identified on three continents. Today, ST131 is the predominant E. coli lineage among extra-intestinal pathogenic E. coli (ExPEC) isolates worldwide.

Retrospective studies have suggested that it may originally have risen to prominence as early as 2003

Marie-Hélène Nicolas-Chanoine, Xavier Bertrand, and Jean-Yves Madec

Global dissemination of a multidrug-resistant Escherichia coli clone

Nicola K. Pettya,b,c,1, Nouri L. Ben Zakoura,b,1, Mitchell Stanton-Cooka,b, Elizabeth Skippingtona,b, Makrina Totsikaa,b,Brian M. Fordea,b, Minh-Duy Phana,b, Danilo Gomes Moriela,b, Kate M. Petersa,b, Mark Daviesa,b,d, Benjamin A. Rogerse,Gordon Dougand, Jesús Rodriguez-Bañof,g, Alvaro Pascualf,g, Johann D. D. Pitouth,i, Mathew Uptonj,David L. Patersona,e, Timothy R. Walshk, Mark A. Schembria,b,2, and Scott A. Beatsona,b,

Light as a potential treatment for pandemic coronavirus infections: A perspective 

"The evidence shows that violet/blue (400–470 nm) light is antimicrobial against numerous bacteria, and that it accounts for Niels Ryberg Finsen's Nobel-winning treatment of tuberculosis. Further evidence shows that blue light inactivates several viruses, including the common flu coronavirus, and that in experimental animals, red and near infrared light reduce respiratory disorders, similar to those complications associated with coronavirus infection."

Chukuka Samuel Enwemeka, Violet Vakunseh Bumah, Daniela Santos Masson-Meyers 

Proceedings of Light-Activated Tissue Regeneration and Therapy Conference

First book to present the mechanism explaining why light is effective in the treatment of so many illnesses and diseases.

• Offers a systematic approach to the field of Light-Activated Tissue Regeneration and Therapy covering theory, basic research, clinical studies, and therapies.

• 
  

• Includes extensive papers and coverage on such interesting topics as pain, wound healing, diabetes, cardiovascular and stroke repair, neuroscience/progenitor, and stem cells.

Editors: Ronald Waynant, Darrell B. Tata

                               SUPER-SUPERBUG CLONES INVADE THE GULF STATES   

UQ Centre for Clinical Research group leader Dr Hosam Zowawi said his team had witnessed rapid growth of the new multi-drug resistant clones – variants of existing superbugs in the Gulf States, but which had never before seen in the region.