Saturday, January 27, 2024

 





IMAGES: CULTURE / PLEOSPORA SP.






                                                                                                                                   

                                                                  >Contig_1

ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA


@ NCBI BLAST

Friday, January 27, 2023






IMAGES: CULTURE / PLEOSPORA SP










                                                                













The synanamorphs and teleomorphs of Phoma have been poorly investigated thus far, except for the P. lingam complex. Few synanamorph relationships have thus far been confirmed by means of molecular techniques. Arenal et al. (2000, 2004) demonstrated P. epicoccina and Epicoccum nigrum to be synanamorphs by employing ITS sequence data, and synonymised these species after further microscopical studies." 


Biology and recent developments in the systematics of Phoma, a complex genus of major quarantine significance.

M. AveskampJ. GruyterP. Crous


The other black fungi: exploring the opportunists in the order Pleosporales

Sarah Ahmed - Ervin M Alcanzo - Qirui Li - Nadir Musa Abuzeid -Xin Zhou - Peiying Feng -

Dea Garcia-Hermoso - Sybren de Hoog


"Additionally, deep-seated infections generally exhibit a predilection for immunocompromised hosts, but cases with cerebral dissemination are more common in immunocompetent individuals. "



Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identification and therapy 

Deanna A. Sutton



Coelomycetous Fungi in the Clinical Setting: Morphological Convergence and Cryptic Diversity


Nicomedes Valenzuela-Lopez, Deanna A. Sutton, José F. Cano-Lira, Katihuska Paredes, 
Nathan Wiederhold, Josep Guarro, and Alberto M. Stchigel






Saturday, January 14, 2023






Antimicrobial blue light inactivation of international clones of multidrug-resistant Escherichia coli ST10, ST131 and ST648




Carolina dos Anjos, Caetano P. Sabino, Vanessa Bueris, Miriam R. Fernandes, Fabio C.Pogliani, Nilton Lincopan, 
Fábio P. Sellera












In 2008, a previously unknown Escherichia coli clonal group, sequence type 131 (ST131), was identified on three continents. Today, ST131 is the predominant E. coli lineage among extra-intestinal pathogenic E. coli (ExPEC) isolates worldwide.


Retrospective studies have suggested that it may originally have risen to prominence as early as 2003


Marie-Hélène Nicolas-Chanoine, Xavier Bertrand, and Jean-Yves Madec






Nicola K. Pettya,b,c,1, Nouri L. Ben Zakoura,b,1, Mitchell Stanton-Cooka,b, Elizabeth Skippingtona,b, Makrina Totsikaa,b,Brian M. Fordea,b, Minh-Duy Phana,b, Danilo Gomes Moriela,b, Kate M. Petersa,b, Mark Daviesa,b,d, Benjamin A. Rogerse,Gordon Dougand, Jesús Rodriguez-Bañof,g, Alvaro Pascualf,g, Johann D. D. Pitouth,i, Mathew Uptonj,David L. Patersona,e, Timothy R. Walshk, Mark A. Schembria,b,2, and Scott A. Beatsona,b,





Light as a potential treatment for pandemic coronavirus infections: A perspective 


"The evidence shows that violet/blue (400–470 nm) light is antimicrobial against numerous bacteria, and that it accounts for Niels Ryberg Finsen's Nobel-winning treatment of tuberculosis. Further evidence shows that blue light inactivates several viruses, including the common flu coronavirus, and that in experimental animals, red and near infrared light reduce respiratory disorders, similar to those complications associated with coronavirus infection."


Chukuka Samuel Enwemeka, Violet Vakunseh Bumah, Daniela Santos Masson-Meyers 








First book to present the mechanism explaining why light is effective in the treatment of so many illnesses and diseases.
  • Offers a systematic approach to the field of Light-Activated Tissue Regeneration and Therapy covering theory, basic research, clinical studies, and therapies.


  • Includes extensive papers and coverage on such interesting topics as pain, wound healing, diabetes, cardiovascular and stroke repair, neuroscience/progenitor, and stem cells.



Editors: Ronald Waynant, Darrell B. Tata