Saturday, September 6, 2025

Monday, June 16, 2025










Medical Professional Monograph LL-37 







Olorofim for the treatment of invasive fungal diseases in patients with few or no therapeutic options: 

a single- arm, open-label, phase 2b study    








Iman Haghania - Zahra Yahyazadeh - Mohammad Taghi Hedayati-Tahereh Shokohi - Hamid Badali - Shaghayegh Khojasteh - Javad Akhtari - Javad Javidnia - Maryam Moazeni - Ahmed Al-Harrasi - Seyed Reza Aghili - Firoozeh Kermani - Zohreh Hajheydari - Abdullah M.S. Al Hatmi - Mahdi Abastabar 




 



A fungus that can ‘eat you from the inside out’ could spread as the world heats up.

By Laura Paddison

*




Deadly fungus that 'eats you from the inside out' invades US: 'Hundreds of thousands of lives at risk'

By OSHEEN YADAV FOR DAILYMAIL.COM


Pan-azole- and multi-fungicide-resistant Aspergillus fumigatus is widespread in the United States

Authors: B. N. Celia-Sanchez, B. Mangum, L. F. Gómez Londoño, C. Wang, B. Shuman, M. T. Brewer, M. Momany


Climate change-driven geographical shifts in Aspergillus species habitat and the implications for plant and human health

Norman van Rhijn 1, Christopher Uzzell 2, Jennifer Shelton 3

1 University of Manchester, 2 Liverpool School of Tropical Medicine, 3 UK Centre for Ecology & Hydrology







Wednesday, June 4, 2025









Cannabis extract could treat fungal diseases

Peer-Reviewed Publication

Macquarie University’s Dr Hue Dinh, a postdoctoral research fellow in the School of Natural Science, and Associate Professor Amy Cain, resolved to tackle the growing threat of fungal infections with help from Professor Mark Connor and Dr Marina Junqueira Santiago from the Macquarie School of Medicine and collaborators at the Universities of Sydney and NSW.

Writer: Bianca Nogrady


Saturday, January 27, 2024

 





IMAGES: CULTURE / PLEOSPORA SP.






                                                                                                                                   

                                                                  >Contig_1

ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA


@ NCBI BLAST

Friday, January 27, 2023






IMAGES: CULTURE / PLEOSPORA SP










                                                                













The synanamorphs and teleomorphs of Phoma have been poorly investigated thus far, except for the P. lingam complex. Few synanamorph relationships have thus far been confirmed by means of molecular techniques. Arenal et al. (2000, 2004) demonstrated P. epicoccina and Epicoccum nigrum to be synanamorphs by employing ITS sequence data, and synonymised these species after further microscopical studies." 


Biology and recent developments in the systematics of Phoma, a complex genus of major quarantine significance.

M. AveskampJ. GruyterP. Crous


The other black fungi: exploring the opportunists in the order Pleosporales

Sarah Ahmed - Ervin M Alcanzo - Qirui Li - Nadir Musa Abuzeid -Xin Zhou - Peiying Feng -

Dea Garcia-Hermoso - Sybren de Hoog


"Additionally, deep-seated infections generally exhibit a predilection for immunocompromised hosts, but cases with cerebral dissemination are more common in immunocompetent individuals. "



Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identification and therapy 

Deanna A. Sutton



Coelomycetous Fungi in the Clinical Setting: Morphological Convergence and Cryptic Diversity


Nicomedes Valenzuela-Lopez, Deanna A. Sutton, José F. Cano-Lira, Katihuska Paredes, 
Nathan Wiederhold, Josep Guarro, and Alberto M. Stchigel